********************************************************************************
MEME - Motif discovery tool
********************************************************************************
MEME version 5.3.2 (Release date: Fri Feb 5 17:50:07 2021 -0800)

For further information on how to interpret these results please access https://meme-suite.org/meme.
To get a copy of the MEME Suite software please access https://meme-suite.org.

********************************************************************************


********************************************************************************
REFERENCE
********************************************************************************
If you use this program in your research, please cite:

Timothy L. Bailey and Charles Elkan,
"Fitting a mixture model by expectation maximization to discover
motifs in biopolymers", Proceedings of the Second International
Conference on Intelligent Systems for Molecular Biology, pp. 28-36,
AAAI Press, Menlo Park, California, 1994.
********************************************************************************


********************************************************************************
TRAINING SET
********************************************************************************
PRIMARY SEQUENCES= common/Klf1-200.fa
CONTROL SEQUENCES= --none--
ALPHABET= ACGT

********************************************************************************

********************************************************************************
COMMAND LINE SUMMARY
********************************************************************************
This information can also be useful in the event you wish to report a
problem with the MEME software.

command: meme common/Klf1-200.fa -oc results/meme37 -mod oops -dna -revcomp -brief 0 -nmotifs 2 -objfun cd -maxw 30 -searchsize 40000 -norand -nostatus -mpi 

model:  mod=          oops    nmotifs=         2    evt=           inf
objective function:           em=       Central Enrichment: p-value of mean distance
                              starts=   Mean distance of best site from center
strands: + -
width:  minw=            8    maxw=           30
nsites: minsites=      200    maxsites=      200    wnsites=       0.8
theta:  spmap=         uni    spfuzz=        0.5
em:     prior=   dirichlet    b=            0.01    maxiter=        50
        distance=    1e-05
data:   n=          100000    N=             200
sample: seed=            0    hsfrac=        0.5
        searchsize=  40000    norand=        yes    csites=         -1
Letter frequencies in dataset:
A 0.256 C 0.244 G 0.244 T 0.256 
Background letter frequencies (from file dataset with add-one prior applied):
A 0.256 C 0.244 G 0.244 T 0.256 
Background model order: 0
********************************************************************************


********************************************************************************
MOTIF RGMWGGGTGTGGCYNSNKNN MEME-1	width =  20  sites = 200  llr = 1434  p-value = 1.8e-004  E-value = 1.8e-004
********************************************************************************
--------------------------------------------------------------------------------
	Motif RGMWGGGTGTGGCYNSNKNN MEME-1 Description
--------------------------------------------------------------------------------
Simplified        A  4234:::1:12111223122
pos.-specific     C  113::::2:::164232222
probability       G  2521999:937611343433
matrix            T  222511:7:61233322333

         bits    2.0                     
                 1.8                     
                 1.6       * *           
                 1.4     *** *           
Relative         1.2     *** *           
Entropy          1.0     *** *           
(10.3 bits)      0.8     *** * *         
                 0.6    ********         
                 0.4    **********       
                 0.2 ** ***********   *  
                 0.0 --------------------

Multilevel           AGCTGGGTGTGGCCGGGGGT
consensus            GTAA     G TTTTCATTG
sequence                           C T AC
                                     C C 
--------------------------------------------------------------------------------

--------------------------------------------------------------------------------
	Motif RGMWGGGTGTGGCYNSNKNN MEME-1 position-specific scoring matrix
--------------------------------------------------------------------------------
log-odds matrix: alength= 4 w= 20 n= 67785 bayes= 9.40269 E= 1.8e-004 
    74    -94      2    -37 
   -53    -94    100    -30 
    31     51    -54    -61 
    60   -383   -186    104 
  -250   -406    186   -221 
  -333   -406    188   -197 
  -286   -331    192   -406 
  -115    -32   -331    138 
  -406   -331    192   -286 
  -221   -281     12    133 
   -55   -331    155   -159 
  -159   -122    121     -6 
  -143    121   -171      5 
   -92     80   -136     43 
   -39    -12     27     16 
   -47     22     62    -72 
    -1    -18     27    -12 
  -115    -32     80      5 
   -12    -18     27     -1 
   -39    -18     22     25 
--------------------------------------------------------------------------------

--------------------------------------------------------------------------------
	Motif RGMWGGGTGTGGCYNSNKNN MEME-1 position-specific probability matrix
--------------------------------------------------------------------------------
letter-probability matrix: alength= 4 w= 20 nsites= 200 E= 1.8e-004 
 0.427940  0.127060  0.247060  0.197940 
 0.177940  0.127060  0.487060  0.207940 
 0.317940  0.347060  0.167060  0.167940 
 0.387940  0.017060  0.067060  0.527940 
 0.045377  0.014623  0.884623  0.055377 
 0.025377  0.014623  0.894623  0.065377 
 0.035377  0.024623  0.924623  0.015377 
 0.115377  0.194623  0.024623  0.665377 
 0.015377  0.024623  0.924623  0.035377 
 0.055377  0.034623  0.264623  0.645377 
 0.175377  0.024623  0.714623  0.085377 
 0.085377  0.104623  0.564623  0.245377 
 0.095377  0.564623  0.074623  0.265377 
 0.135377  0.424623  0.094623  0.345377 
 0.195377  0.224623  0.294623  0.285377 
 0.185377  0.284623  0.374623  0.155377 
 0.255377  0.214623  0.294623  0.235377 
 0.115377  0.194623  0.424623  0.265377 
 0.235377  0.214623  0.294623  0.255377 
 0.195377  0.214623  0.284623  0.305377 
--------------------------------------------------------------------------------

--------------------------------------------------------------------------------
	Motif RGMWGGGTGTGGCYNSNKNN MEME-1 regular expression
--------------------------------------------------------------------------------
[AG][GT][CA][TA]GGGTG[TG]G[GT][CT][CT][GTC][GC][GATC][GT][GTAC][TGC]
--------------------------------------------------------------------------------




Time  3.27 secs.

********************************************************************************


********************************************************************************
MOTIF TNVHHBCTBNYYBNHHYYYCTTVTCTCTGB MEME-2	width =  30  sites = 200  llr = 1155  p-value = 7.6e-001  E-value = 1.3e+000
********************************************************************************
--------------------------------------------------------------------------------
	Motif TNVHHBCTBNYYBNHHYYYCTTVTCTCTGB MEME-2 Description
--------------------------------------------------------------------------------
Simplified        A  12223112121112332111114:11:112
pos.-specific     C  222423524243332345352222717122
probability       G  2341132122112221111211221:1:63
matrix            T  532243253434434333516626181713

         bits    2.0                               
                 1.8                               
                 1.6                               
                 1.4                               
Relative         1.2                               
Entropy          1.0                          *    
(8.3 bits)       0.8                          ***  
                 0.6                         ****  
                 0.4                     ** ****** 
                 0.2 *  ****** **    ****** ****** 
                 0.0 ------------------------------

Multilevel           TTGCTCCTCTCTTTTACCTCTTATCTCTGG
consensus            CGCAATTATCTCCCATTTC  CC      T
sequence              AATCG  GA    CC      G      C
                              G                    
--------------------------------------------------------------------------------

--------------------------------------------------------------------------------
	Motif TNVHHBCTBNYYBNHHYYYCTTVTCTCTGB MEME-2 position-specific scoring matrix
--------------------------------------------------------------------------------
log-odds matrix: alength= 4 w= 30 n= 65785 bayes= 9.43658 E= 1.3e+000 
  -114    -14    -66     99 
   -31    -45     16     42 
   -31     -7     69    -62 
    -5     79   -114    -22 
     3      1   -155     68 
  -158     42     16     30 
  -158    108    -45    -22 
   -31    -35   -155    102 
  -106     63     -1      1 
   -33     -1    -27     46 
   -81     67   -105     45 
   -81     51   -123     65 
   -95     33    -30     50 
   -56     27    -30     39 
    -1    -11    -63     50 
    33     13   -123     27 
   -68     86   -143     27 
  -128     98   -105     20 
  -128     27   -105     92 
   -81    114    -40    -95 
   -88    -56   -210    132 
  -138    -25    -82    112 
    58    -16    -16    -51 
  -252    -35    -69    126 
  -191    153    -72   -165 
  -198   -166   -274    168 
  -264    158   -101   -124 
   -88   -154   -250    152 
  -103    -45    126   -119 
   -75      1     42     10 
--------------------------------------------------------------------------------

--------------------------------------------------------------------------------
	Motif TNVHHBCTBNYYBNHHYYYCTTVTCTCTGB MEME-2 position-specific probability matrix
--------------------------------------------------------------------------------
letter-probability matrix: alength= 4 w= 30 nsites= 200 E= 1.3e+000 
 0.116055  0.221783  0.154216  0.507947 
 0.207186  0.177949  0.272544  0.342321 
 0.207186  0.232003  0.394165  0.166645 
 0.247727  0.421192  0.110382  0.220699 
 0.261240  0.245517  0.083355  0.409889 
 0.085564  0.326598  0.272544  0.315294 
 0.085564  0.515787  0.177949  0.220699 
 0.207186  0.191463  0.083355  0.517997 
 0.122642  0.377358  0.242223  0.257777 
 0.203723  0.242223  0.201683  0.352371 
 0.146205  0.387579  0.117308  0.348908 
 0.146205  0.347038  0.103795  0.402962 
 0.132692  0.306498  0.198389  0.362421 
 0.173232  0.292984  0.198389  0.335394 
 0.254313  0.225416  0.157849  0.362421 
 0.321881  0.265957  0.103795  0.308367 
 0.159719  0.441633  0.090281  0.308367 
 0.105665  0.482173  0.117308  0.294854 
 0.105665  0.292984  0.117308  0.484043 
 0.146205  0.536227  0.184876  0.132692 
 0.139278  0.164776  0.056668  0.639278 
 0.098738  0.205316  0.137749  0.558197 
 0.382522  0.218830  0.218830  0.179819 
 0.044684  0.191803  0.151262  0.612251 
 0.068247  0.702023  0.147969  0.081761 
 0.064784  0.077108  0.036567  0.821541 
 0.041220  0.729050  0.120942  0.108788 
 0.139278  0.083695  0.043154  0.733873 
 0.125765  0.178289  0.583695  0.112251 
 0.152792  0.245857  0.326938  0.274414 
--------------------------------------------------------------------------------

--------------------------------------------------------------------------------
	Motif TNVHHBCTBNYYBNHHYYYCTTVTCTCTGB MEME-2 regular expression
--------------------------------------------------------------------------------
[TC][TGA][GCA][CAT][TAC][CTG][CT][TA][CTG][TCAG][CT][TC][TC][TC][TAC][ATC][CT][CT][TC]CT[TC][ACG]TCTCTG[GTC]
--------------------------------------------------------------------------------




Time  6.38 secs.

********************************************************************************

********************************************************************************
Stopped because requested number of motifs (2) found.
********************************************************************************

CPU: Timothys-Mac-Mini.local

********************************************************************************
